Review



pvdf transfer kit biorad  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Bio-Rad pvdf transfer kit biorad
    Pvdf Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 387 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm41850246-215-100-103
    Average 96 stars, based on 387 article reviews
    pvdf transfer kit biorad - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Protease Inhibitor:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Pore Size:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Cloning:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Reverse Transcription:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Transformation Assay:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Western Blot:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021

    Phospho-proteomics:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Data-dependent acquisition:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Targeted Proteomics:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Recombinant:

    Article Title: The phosphorylation landscape of infection-related development by the rice blast fungus.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli Stellar Chemically Competent Cell Takara Bio Cat# 636763 Escherichia coli DH5a TIANGEN Cat# CB101-02 Escherichia coli BL21 Rosetta (DE3) Sigma-Aldrich Cat# 70954 Saccharomyces cerevisiae Y2HGold Takara Bio Cat# 630498 Antibodies pTEpY (p44/42 MAPK) antibody Cell Signaling Technology Cat# 4370S; RRID: AB_2315112 pS/pT-P antibody Abcam Cat# ab9344; RRID: AB_307195 GFP antibody Santa Cruz Biotechnology Cat# sc-9996; RRID: AB_627695 Actin antibody Agrisera com Cat# AS13 2640; RRID: AB_2722610 6xHis antibody Abcam Cat# ab1187; RRID: AB_298652 Rabbit secondary antibody Cell Signaling Technology Cat# 7074S; RRID: AB_2099233 Chemicals, peptides, and recombinant proteins 1, 16 Hexadecanediol Sigma-Aldrich Cat# 177482 Urea Sigma-Aldrich Cat# U5128 Protease Inhibitor Cocktail Sigma-Aldrich Cat# P9599 Tris (2-carboxyethyl) phosphine (TCEP) Merck Cat# 646547 Iodoacetamide Merck Cat# I6125 Ammonium bicarbonate Merck Cat# A6141 Trypsin Pierce Cat# 90058 Titanium dioxide (TiO2) GL Science Cat# 5020-75000 Phthalic acid Merck Cat# 402915 Acetonitrile Optima LC/MS grade Thermo Fisher Cat# 10489553 Water Optima LC/MS grade Thermo Fisher Cat# 10505904 Formic acid Thermo Fisher Cat# 10723857 Hexadecyltrimethylammonium bromide (CTAB) Thermo Fisher Cat# 10596814 Phenol – chloroform – isoamyl alcohol mixture Sigma-Aldrich Cat# 77617 Isopropanol Fisher Scientific Cat# 10628143 Sodium acetate (NaOAc) Sigma-Aldrich Cat# 32319 Calcium Chloride Fisher Scientific Cat# 10171800 PEG4000 Sigma-Aldrich Cat# 81240 Magnesium sulfate Fisher Scientific Cat# 10697412 Sodium phosphate dibasic heptahydrate Sigma-Aldrich Cat# S9390 Glucanex Sigma-Aldrich Cat# L1412 Hygromycin B Roche Cat# 10843555001 Glufosinate ammonium (Basta) Sigma-Aldrich Cat# 45520 X-a-gal Takara Cat# 630463 Aureobasidin A Takara Cat# 630499 DL-Dithiothreitol (DTT) Sigma-Aldrich Cat# D9163 EDTA Sigma-Aldrich Cat# 60-00-4 Phosphatase inhibitor tablets PhosphoSTOP Roche Cat# 4906845001 Quick Start Bradford 1x Dye Reagent BioRad Cat# 5000205 4x Laemmli sample buffer BioRad Cat# 1610747 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat# A9647 (Continued on next page) e1 Cell 187, 2557–2573.e1–e9, May 9, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tween20 Sigma-Aldrich Cat# P2287 cOmplete EDTA-free protease inhibitor cocktail Roche Cat# 11873580001 GFP-Trap agarose beads ChromoTek Cat# gta ATP Sigma-Aldrich Cat# A7699 SuperSignal West Femto Maximum Sensitivity Substrate Thermo Scientific Cat# 34096 Critical commercial assays C18 SepPak colums Waters Cat# WAT020805 C18 microspin columns The Neast Group Cat# 74-4601 Mobicol columns 2B Scientific Cat# M1002 Filter (small) 10 um pore size 2B Scientific Cat# M2110 In-Fusion HD Cloning Kit Takara Cat# 639650 GoScript Reverse Transcription System Promega Cat# A5000 Qubit BR assay Thermo Fisher Cat# Q32850 Frozen-EZ Yeast Transformation II Zymo Research Cat# T2001 Trans-Blot Turbo RTA Mini 0.2 mm PVDF transfer kit BioRad Cat# 1704272 RNeasy Plant Mini Kit QIAGEN Cat# 74904 Pierce ECL Western Blotting Substrate Thermo Scientific Cat# 32106 Deposited data Appressorium phosphoproteomics DDA data This paper Pride: PXD044830 Appressorium phosphoproteomics PRM data This paper Panorama: PXD044865 Experimental models: Organisms/strains Magnaporthe oryzae Guy11 Leung et al.66 N/A Dpmk1 Xu and Hamer5 N/A Dpmk1:Pmk1-GFP Sakulkoo et al.6 N/A Guy11:ToxA:GFP Ryder et al.3 N/A pmk1AS Sakulkoo et al.6 N/A Guy11: Vts1-GFP This paper N/A Dvts1:Vts1 This paper N/A Dvts1:Vts1A175 This paper N/A Dvts1:Vts1D175 This paper N/A Dvts1:Vts1A420 This paper N/A Dvts1:Vts1D420 This paper N/A Oryza sativa cultivar CO-39 Talbot et al.67 N/A Oligonucleotides Primers are listed in Table S1 This paper N/A Recombinant DNA pScBAR-Vts1-GFP This paper N/A pScBAR-Vts1A175 This paper N/A pScBAR-Vts1D175 This paper N/A pScBAR-Vts1A420 This paper N/A pScBAR-Vts1D420 This paper N/A MEK2DD Menke et al.71 N/A MPK6 Menke et al.71 N/A pOPINJ-Pmk1 This paper N/A pOPINF-Vts1 This paper N/A pGADT7-Pmk1 Óses-Ruiz et al.7 N/A pGBKT7-Mst12 Óses-Ruiz et al.7 N/A pGBKT7-14-3-4 This paper N/A (Continued on next page) ll OPEN ACCESS Cell 187, 2557–2573.e1–e9, May 9, 2024 e2 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER pGBKT7-MGG_00345 This paper N/A pGBKT7-MGG_00454 This paper N/A pGBKT7-MGG_00800 This paper N/A pGBKT7-MGG_00803 This paper N/A pGBKT7-MGG_01279 This paper N/A pGBKT7-MGG_01311 This paper N/A pGBKT7-MGG_01376 This paper N/A pGBKT7-MGG_01836 This paper N/A pGBKT7-MGG_03139 This paper N/A pGBKT7-MGG_03196 This paper N/A pGBKT7-MGG_03218 This paper N/A pGBKT7-MGG_03558 This paper N/A pGBKT7-MGG_04708 This paper N/A pGBKT7-MGG_04790 This paper N/A pGBKT7-MGG_05199 This paper N/A pGBKT7-MGG_05220 This paper N/A pGBKT7-MGG_06258 This paper N/A pGBKT7-MGG_06334 This paper N/A pGBKT7-MGG_06393 This paper N/A pGBKT7-MGG_06403 This paper N/A pGBKT7-MGG_06726 This paper N/A pGBKT7-MGG_07667 This paper N/A pGBKT7-MGG_07714 This paper N/A pGBKT7-MGG_08061 This paper N/A pGBKT7-MGG_08097 This paper N/A pGBKT7-MGG_09293 This paper N/A pGBKT7-MGG_09554 This paper N/A pGBKT7-MGG_09697 This paper N/A pGBKT7-MGG_09898 This paper N/A pGBKT7-MGG_10538 This paper N/A pGBKT7-MGG_12865 This paper N/A pGBKT7-MGG_14847 This paper N/A Software and algorithms tidyverse Wickham et al.81 https://www.tidyverse.org/ ImageJ NIH https://imagej.net/ BioRender Biorender https://biorender.com/ GraphPad Prism 8 GraphPad https://imagej.nih.gov/ij/ MSConvert package Matrix Science https://proteowizard.sourceforge.io/ Mascot server v.2.4.1 Matrix Science https://www.matrixscience.com/ search_form_select.html Scaffold v.5 Proteome Software https://www.proteomesoftware. com/products/scaffold-5 Proteome Discoverer 2.5 Thermo Fisher Scientific Cat# OPTON-31014 ll OPEN ACCESS Resource

    Transfection:

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021

    Enzyme-linked Immunosorbent Assay:

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    SYBR Green Assay:

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Electron Microscopy:

    Article Title: Structural basis for IL-12 and IL-23 receptor sharing reveals a gateway for shaping actions on T versus NK cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Cytofix/Cytoperm kit BD Cat#554714 ExpiFectamine 293 Transfection Kit GIBCO Cat#A14525 Sapphire Baculovirus DNA Allele Cat#ABP-BVD-10002 ELISA MAX Deluxe Set Mouse IFN-g BioLegend Cat#430804 ELISA MAX Deluxe Set Human IFN-g BioLegend Cat#430104 Nunc MaxiSorp ELISA plates, uncoated BioLegend Cat#423501 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 RNeasy Plus Mini Kit QIAGEN Cat#74134 iScript Reverse Transcription Supermix BioRad Cat#1708840 PowerTrack SYBR Green Applied Biosystems Cat#A46109 FixLyse Buffer BD Cat#558049 Perm Buffer III BD Cat#558050 CellTrace Violet Proliferation Kit Invitrogen Cat#C34557 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat#1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Deposited data IL-12Rb1 D1-D2 Crystal Structure RCSB 6WDP IL-23 Receptor Complex Crystal Structure RCSB 6WDQ IL-23 Receptor Complex Electron Microscopy EMDB EMD-21646 IL-12 Receptor Complex Electron Microscopy EMDB EMD-21645 Experimental models: cell lines Mouse: B16-F10 ATCC Cat#CRL-6475 Mouse: MC-38 Kerafast Cat#ENH204-FP Human: Expi293F GIBCO Cat#A14527 Human: HEK293S GnTI- Gift of H. Gobind Khorana (Reeves et al., 2002) N/A Insect: Spodoptera frugiperda (Sf9) ATCC Cat#CRL-1711 Insect: Trichoplusia ni (T. ni) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Mouse: OT-I C57BL/6-Tg(TcraTcrb) 1100Mjb/j The Jackson Laboratory JAX:003831 Mouse: Thy1.1 B6.PL-Thy1a/CyJ The Jackson Laboratory JAX: 000406 Yeast: EBY100 ATCC Cat#MYA-4941 Recombinant DNA pAcSG2 GP64SP-hP40(23-328)-6xHis This Study N/A pAcSG2 GP64SP-hIL-23p19(20189)-6xHis This Study N/A pAcSG2 GP64SP-hIL-12Rb1(25239)-6xHis This Study N/A (Continued on next page) ll Cell 184, 983–999.e1–e12, February 18, 2021 e4 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pAcSG2 BD Cat#554769 pVLAD6 Dukkipati et al., 2008 RRID:Addgene_41850 pAcGP67a BD Cat#554756 pD649 Wojtowicz et al., 2020 RRID:Addgene_156487 pCT302 Midelfort et al., 2004 RRID:Addgene_41845 pCDH-EF1-cOVA-T2A-copGFP Tseng et al., 2013 N/A Software and algorithms FlowJo v10.5 Tree Star RRID: SCR_008520 GraphPad Prism 8.3.0 GraphPad Software RRID: SCR_002798 BIAevaluation software Cytiva RRID: SCR_015936 StepOne Software Applied Biosystems RRID:SCR_014281 Phenix Liebschner et al., 2019 RRID:SCR_014224 Coot Emsley et al., 2010 RRID:SCR_014222 SBGrid Morin et al., 2013 RRID:SCR_003511 Fiji Schindelin et al., 2012 RRID:SCR_002285 MTrack2 Klopfenstein and Vale, 2004 N/A Oligonucleotides Gapdh 50 primer 50- GTGGAGTCATACTGGAACATGTAG-30 IDT N/A Gapdh 30 primer 50- AATGGTGAAGGTCGGTGTG 30 IDT N/A Ifng 50 primer 50- TCCACATCTATGCCACTTGAG 30 IDT N/A Ifng 30 primer 50- CTGAGACAATGAACGCTACACA 30 IDT N/A Tigit 50 primer 50- GTAAGATGACAGAGCCACCTTC 30 IDT N/A Tigit 30 primer 50- CTGCCTTCCTCGCTACAG 30 IDT N/A ll

    Polymerase Chain Reaction:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Enzyme-linked Immunospot:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Cell Isolation:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Cell Stimulation:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Staining:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    SNP Genotyping Assay:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Isolation:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Stable Transfection:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Expressing:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    CRISPR:

    Article Title: Inhibition of MAPK p38α overcomes the cancer immunosurveillance defect caused by FPR1 loss-of-function mutation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pCDH-lenti-FPR1_T360E This paper N/A pCDH-lenti-Empty vector This paper N/A pCDH-lenti-ZsGreen-OVA This paper N/A Biological samples Healthy adult peripheral blood mononuclear cells (PBMCs) CTIBiotech France Cat# CTICC.IMPB.1 Chemicals, peptides, and recombinant proteins β-mercaptoethanol Sigma-Aldrich Cat# M3148 Dexamethasone Sigma-Aldrich Cat# D0700000 Doxycycline hyclate Sigma-Aldrich Cat# D3000000 Recombinant murine GM-CSF Miltenyi Biotec Cat# 130-095-735 SCREEN-WELL® ICCB Known Bioactives library Enzo Life Sciences Cat# BML-2840 MAPK Compound Library MedChemExpress Cat# HY-L010; library ID: HY-LD-000005319 SB203580 MedChemExpress Cat# HY-10256 SB239063 MedChemExpress Cat# HY-11068 Skepinone-L MedChemExpress Cat# HY-15300 Pamapimod MedChemExpress Cat# HY-10405 Doramapimod MedChemExpress Cat# HY-10320 Ralimetinib MedChemExpress Cat# HY-13241 Losmapimod MedChemExpress Cat# HY-10402 PD98059 MedChemExpress Cat# HY-12028 Cyclosporin H MedChemExpress Cat# HY-P1122 HCH6-1 MedChemExpress Cat# HY-101283 Bumetanide MedChemExpress Cat# HY-17468 DDR1-IN-1 MedChemExpress Cat# HY-13979 DDR1-IN-2 MedChemExpress Cat# HY-U00444 N-Formyl-Met-Leu-Phe (FMLP) Sigma-Aldrich Cat# 47729-10MG-F ERK Activation Inhibitor Peptide I, Cell-Permeable Sigma-Aldrich Cat# 328000 Ovalbumin (OVA) Sigma-Aldrich Cat# A5503 Oxaliplatin (OXA) Sigma-Aldrich Cat# Y0000271 Mitoxantrone dihydrochloride (MTX) Sigma-Aldrich Cat# M6545 cyclophosphamide (CTX) Sigma-Aldrich Cat# C3250000 Azoxymethane (AOM) Sigma-Aldrich Cat# A5486 dextran sulfate sodium (DSS) Life Technologies Cat# J63606.22 CFSE Biolegend Cat# 423801 Collagenase type IV Life Technologies Cat# 17104019 DNAse I Sigma-Aldrich Cat# DN25 D-Biotin Sigma-Aldrich Cat# B4639 Recombinant human GM-CSF Miltenyi Biotec Cat# 130-093-867 Recombinant Human IFN-α2 Biolegend Cat# 592706 Human Sera Type AB, Heat-inactivated Institut de Biotechnologies Jacques Boy Cat# 201021334 Critical commercial assays PKH26 staining kit Sigma-Aldrich Cat# PKH26GL DharmaFECT #1 transfection reagent Horizon Discovery Cat# T-2001-04 DharmaFECT Duo transfection reagent Horizon Discovery Cat# T-2010-03 MycoStripTM Mycoplasma Detection Kit InvivoGen Cat# rep-mysnc-100 CellTracker blue Life Technologies Cat# C2110 CellTracker red Life Technologies Cat# C34552 (Continued on next page) e2 Cell Reports Medicine 7, 102683, March 17, 2026 .. REAGENT or RESOURCE SOURCE IDENTIFIER CellTracker green Life Technologies Cat# C2925 CellTracker deep red Life Technologies Cat# C34565 LIVE/DEAD fixable yellow dye Life Technologies Cat# L34959 PureLinkTM Genomic DNA Mini Kit Life Technologies Cat# K182002 DreamTaq Green PCR Master Mix Life Technologies Cat# K1082 5× ELISA coating buffer Biolegend Cat# 421701 1-StepTM Ultra TMB-ELISA substrat solution Life Technologies Cat# 34028 RNeasy Plus Mini Kit Qiagen Cat# 74134 NuPAGETM LDS Sample Buffer (4×) Life Technologies Cat# NP0007 4–12% NuPAGE® Bis-Tris gels Life Technologies Cat# NP0336BOX NuPAGETM MES SDS Running Buffer (20×) Life Technologies Cat# NP000202 Trans-Blot Turbo RTA Mini 0.2 μm PVDF Transfer Kit BioRad Cat# 1704272 ECL start Western Blotting Detection Reagent Cytiva Cat# RPN3244 Mouse IFN-γ ELISPOT Set BD Bioscience Cat# 551083 Streptavidin-alkaline phosphatase and BCIP/NBT substrate BD Bioscience Cat# 551951 MojoSortTM Mouse CD8 Naive T cell Isolation Kit Biolegend Cat# 480044 Cell Stimulation Cocktail Life Technologies Cat# 00-4975-03 LIVE/DEADTM Fixable Yellow Dead Cell Stain Kit Life Technologies Cat# L34968 Foxp3/Transcription Factor Staining Buffer Set Life Technologies Cat# 00-5523-00 H2Kb-OVA monomer Biolegend Cat# 280051 Streptavidin-PE Biolegend Cat# 405204 DNeasy Blood & Tissue Kit Qiagen Cat# 69506 TaqManTM SNP Genotyping Assay human: 3266374_1_FPR2, FPR1, rs867228 Life Technologies Cat# 4351379 TaqManTM Genotyping Master Mix Life Technologies Cat# 4371353 MojoSortTM Human CD14+ Monocytes Isolation Kit Biolegend Cat# 480048 Deposited data Bulk RNA-Seq: Raw and analyzed data This paper ENA: PRJEB102824; https:// www.ebi.ac.uk/ena/browser/ view/PRJEB102824 Experimental models: Cell lines Murine: Immortalized dendritic cells (iniDCs) Richter C et al.68 N/A Murine: IniDCs stably expressing CRISPR Cas9 This paper N/A Murine: IniDCs Fpr1− /− This paper N/A Murine: IniDCs FprT360E/T360E This paper N/A Murine: IniDCs B2m− /− This paper N/A Murine: B3Z Karttunen et al.69 N/A Murine: MCA205 Sigma-Aldrich Cat# SCC173 Murine: MC38 Sigma-Aldrich Cat# SCC172 Murine: TC1_Luc Lin et al.70 N/A Murine: OP9 ATCC Cat# CRL-2749 Human: U2OS ATCC Cat# HTB-96 Murine: MCA205 ZsGreen-OVA This paper N/A Human: U2OS ZsGreen-OVA This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6JOlaHsd Envigo Cat# 5705F Mouse: OT-I: C57BL/6-Tg(TcraTcrb)1100Mjb/Crl Charles River Laboratories Cat# 642OT1 (Continued on next page) Cell Reports Medicine 7, 102683, March 17, 2026 e3 .. G.K.’s wife, Laurence Zitvogel, has held research contracts with Glaxo Smyth Kline, Incyte, Lytix, Kaleido, Innovate Pharma, Daiichi Sankyo, Pilege, Merus, Transgene, 9 m, Tusk, and Roche, was on the Board of Directors of Transgene, is a cofounder of everImmune, and holds patents covering the treatment of cancer and the therapeutic manipulation of the microbiota.

    Plasmid Preparation:

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021

    Magnetic Beads:

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021

    RNA sequencing:

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021

    Countercurrent Chromatography:

    Article Title: The tissue protective functions of interleukin-22 can be decoupled from pro-inflammatory actions through structure-based design.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER mIL-22BP This Paper N/A EndoH Produced in house N/A Kifunensine Toronto Research Chemicals Cat#K450000 Streptavidin Sigma Cat#189730 Alexa Flour 647 C2 Maleimide Invitrogen Cat#A20347 Cellfectin II GIBCO Cat#10362100 cOmplete protease inhibitor cocktail Roche Cat#5056489001 PhosSTOP Sigma Cat#4906845001 1M HEPES GIBCO Cat#15630-080 Penicillin-streptomycin GIBCO Cat#15140163 2-mercaptoethanol Sigma Cat#M3148 TrypLE GIBCO Cat#12604013 Carboxypeptidase A Sigma Cat#C9268 Carboxypeptidase B Sigma Cat#217356 Expi293 Expression Medium GIBCO Cat#A1435101 Dulbecco’s Modified Eagle’s Medium (DMEM) GIBCO Cat#11960-069 Phosphate Buffered Saline (PBS) GIBCO Cat#20012-050 Fetal Bovine Serum Sigma Cat#F4135-500 Sf-900 III Media Invitrogen Cat#12658019 ESF 921 Insect Cell Culture Medium Expression Systems Cat#96-001-01 D-glucose (dextrose) Sigma Cat#G8270-5KG YPD broth Sigma Cat#Y1375 Bacto Casamino Acids GIBCO Cat#223050 Yeast Nitrogen Base (without amino acids) RPI Cat#Y20040 Sodium Citrate Tribasic Dihydrate Sigma Cat#S4641 Citric Acid Monohydrate Sigma Cat#C1909 D-galactose Sigma Cat#G0625 Biotin Sigma Cat#B4501 16% paraformaldehyde Fisher Scientific Cat#50-980-487 Cerulein Sigma Cat#C9026 Streptavidin/Alexa FluorTM 647 conjugate Produced in house N/A BirA Produced in house (Fairhead and Howarth, 2015) N/A Recombinant murine EGF Peprotech 315-09 Recombinant murine Noggin Peprotech 250-38 Human R-spondin Produced in house N/A N-acetyl cysteine Sigma A7250 Fibronectin EMD Millipore Cat#341635 Critical commercial assays Mouse SAA-1/2 ELISA kit Invitrogen Cat#KMA0021 Mouse Haptoglobin ELISA kit R&D Cat#DY4409-05 iScript Reverse Transcription Supermix BioRad Cat#1708840 RNAEasy plus mini kit QIAGEN Cat#1708840 Streptavidin microbeads Miltenyi Cat#130-048-101 Anti-Cy5/Anti-Alexa Fluor 647 Microbeads Milteny Cat#130-091-395 LS magnetic selection column Miltenyi Cat#130-042-401 EasySep Magnet StemCell Technologies Cat#18000 High Capacity NoEndo Columns Protein Ark Cat#Gen-NoE48HC (Continued on next page) e2 Immunity 54, 660–672.e1–e9, April 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Chromogenic Endotoxin Quant Kit Pierce Cat#A39552 12% Mini-PROTEAN TGX Precast Protein Gels BioRad Cat#4561046 Trans-Blot Turbo RTA Mini 0.2 mm PVDF Transfer Kit BioRad Cat1704272 Blotting-Grade Blocker BioRad Cat#1706404 ECL Prime Western Blotting Detection Reagent Cytiva Cat#45002401 Hyperfilm ECL Cytiva Cat#28906839 Zymoprep Yeast Plasmid Miniprep II Kit Zymo Research Cat#D2004 Anti-HA Magnetic Beads Thermo Cat#88836 FuGene HD Transfection Reagent Fisher Cat#E2312 High-Capacity RNA-to-cDNA Kit Applied Biosystems Cat#4387406 NEBnext Ultra II RNA Library Prep Kit for Illumina NEB Cat# E7770 ExpiFectamin 293 Transfection Kit Thermo Cat#A14525 Deposited data IL22-IL22Ra-IL10Rb complex PDB 6WEO RNA-Seq data (raw and analyzed) NCBI GEO GSE160217 Experimental models: cell lines Human: HEK293T ATCC CRL-1575 Human: HT-29 ATCC HTB-38 Human: Panc-1 ATCC CRL-1469 Human: HepG2 ATCC HB-8065 Human: Expi293F ThermoFisher Cat#A14527 Mouse: EC4 Cao et al., 2011 Yeast: S. cerevisiae EBY100 ATCC MYA-4941 Insect: Spodotera frugiperda (Sf9) ATCC CRL-1711 Insect: Trichoplusia ni (Hi5) Expression Systems Cat#94-002F Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory JAX:000664 Oligonucleotides Gapdh Forward GTG GAG TCA TAC TGG AAC ATG TAG IDT N/A Gapdh Reverse AAT GGT GAA GGT CGG TGT G IDT N/A Il22ra1 Forward CTC GTA TTC TCT CTG TTT GCC T IDT N/A Il22ra1 Reverse CAT GAC CTG TTC TAC CGC TTA G IDT N/A Il10r2 Forward CAG GAC GGA GAC TAT GAG GAT IDT N/A Il10r2 Reverse ACA GAA CAG GAG AGT GGA GT IDT N/A Reg3b Forward TGT TAC TCC ATT CCC ATC CAC IDT N/A Reg3b Reverse CTG AGG CTT CAT TCT TGT CCT IDT N/A Reg3g Forward GAT TCG TCT CCC AGT TGA TGT IDT N/A (Continued on next page) Immunity 54, 660–672.e1–e9, April 13, 2021 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER Reg3g Forward CTC CAT GAC CCG ACA CTG IDT N/A Muc1 Forward GAC TGC TAC TGC CAT TAC CTG IDT N/A Muc1 Reverse CCT ACC ATC CTA TGA GTG AAT ACC IDT N/A Cxcl1 Forward GTG CCA TCA GAG CAG TCT IDT N/A Cxcl1 Reverse CCA AAC CGA AGT CAT AGC CA IDT N/A Il6 Forward TCC TTA GCC ACT CCT TCT GT IDT N/A Il6 Reverse AGC CAG AGT CCT TCA GAG A IDT N/A Il1b Forward CTC TTG TTG ATG TGC TGC TG IDT N/A Il1b Reverse GAC CTG TTC TTT GAA GTT GAC G IDT N/A Isg15 Forward CCC CCA TCA TCT TTT ATA ACC AAC IDT N/A Isg15 Reverse CAC AGT GAT CAA GCA TTT GCG IDT N/A Tnfrsf1 Forward GCC TTC CTG TCA TAG TAT TCC TG IDT N/A Tnfrsf1 Reverse TCT TCG AAC TGC AGC TGT G IDT N/A Tnfsf10 Forward GTT GCT TCT CCG AGT GAT CC IDT N/A Tnfsf10 Reverse TCA GGA CAC CAT TTC TAC AGT TC IDT N/A Olfm4 Forward CAGCCACTTTCCAATTTCACTG PrimerBank 71892419c1 Olfm4 Reverse GCTGGACATACTCCTTCACCTTA PrimerBank 71892419c1 Lgr5 Forward ACATTCCCAAGGGAGCGTTC PrimerBank 110624771c2 Lgr5 Reverse ATGTGGTTGGCATCTAGGCG PrimerBank 110624771c2 Recombinant DNA pAcGP67a BD Cat# 554756 pCT_302 Midelfort et al., 2004 RRID:Addgene_41845 pD649 ATUM Cat#PD649 pLV-EF1a-IRES-Puro Hayer et al., 2016 RRID:Addgene_85132 pD649 HASP-mIL-22 (34-179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (34- 179)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a,’’ 34-179, E43H, S45R, Q49S, Q116W, Q128K)-6xHIS This paper N/A pAcGP67a GP64SP-mIL-22 (‘‘Super-22a’’ glyco-mutant, 34-179, E43H, S45R, Q49S, N68Q, N97Q, Q116W, Q128K)-6xHIS This paper N/A (Continued on next page) e4 Immunity 54, 660–672.e1–e9, April 13, 2021



    Similar Products

    pvdf transfer kit biorad  (Bio-Rad)
    96
    Bio-Rad pvdf transfer kit biorad
    Pvdf Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm41850246-215-100-103
    Average 96 stars, based on 1 article reviews
    pvdf transfer kit biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    trans blot turbo rta midi transfer kit biorad  (Bio-Rad)
    96
    Bio-Rad trans blot turbo rta midi transfer kit biorad
    Trans Blot Turbo Rta Midi Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm40209716-158-106-112
    Average 96 stars, based on 1 article reviews
    trans blot turbo rta midi transfer kit biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    4626 trans blot turbo rta mini transfer kit biorad  (Bio-Rad)
    96
    Bio-Rad 4626 trans blot turbo rta mini transfer kit biorad
    4626 Trans Blot Turbo Rta Mini Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm40209716-158-96-103
    Average 96 stars, based on 1 article reviews
    4626 trans blot turbo rta mini transfer kit biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    pvdf biorad  (Bio-Rad)
    96
    Bio-Rad pvdf biorad
    Pvdf Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+LF+PVDF+Transfer+Kit/pm40067830-240-37-38
    Average 96 stars, based on 1 article reviews
    pvdf biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    biorad kit 1704275  (Bio-Rad)
    95
    Bio-Rad biorad kit 1704275
    Biorad Kit 1704275, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Midi+LF+PVDF+Transfer+Kit/pmc11608315-285-23-23
    Average 95 stars, based on 1 article reviews
    biorad kit 1704275 - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    pvdf membrane biorad  (Bio-Rad)
    96
    Bio-Rad pvdf membrane biorad
    Pvdf Membrane Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm39276772-430-236-238
    Average 96 stars, based on 1 article reviews
    pvdf membrane biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    trans blot turbo transfer system rta transfer kit biorad  (Bio-Rad)
    96
    Bio-Rad trans blot turbo transfer system rta transfer kit biorad
    Trans Blot Turbo Transfer System Rta Transfer Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pvdf+transfer+kit+biorad/Trans-Blot+Turbo+RTA+Mini+PVDF+Transfer+Kit/pm37419112-251-192-199
    Average 96 stars, based on 1 article reviews
    trans blot turbo transfer system rta transfer kit biorad - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier

    Image Search Results